Description
g loomis g2 rods Spinning Rod and Fuji guides Color:Dreamsicle Delight (Lam) Best Lowrance Fish Finders 20% 3-17-23
Best Lowrance Fish Finders – HDS Pro, Elite FS & Eagle – Brushy Creek Marine
complete cds TCAGTGTGAATAGTGTTTAAGTTG /cds=(149,532) 1233 Table 3A Hs.27181 AL136656 12052835 nuclear receptor binding factor-2 TGATGCAAGAGTGGACGTAATGCTAG (NRBF-2), mRNA/cds=(179,1042) TTGGCAGTATTTTATTGTAAGAAA 1234 Table 3A Hs.57209 AL136703 12052925 hypothetical protein DKFZp566J091 TCAGTAAAAATGCCTGTTGTGAGATG (DKFZP566J091), mRNA AACCTCCTGTAACTTCTATCTGTT /cds=(212,529) 1235 Table 3A Hs.166254 AL136711 12052941 hypothetical protein DKFZp566H 33 GGGCCATTTTATGATGCATTGCACAC (DKFZP566I133), mRNA CCTCTGGGGAAATTGATCTTTAAA /cds=(133,1353) 1236 Table 3A Hs.324275 AL136739 12052996 WW domain-containing protein 1 AAAATGCTGCTGGCTTTTCTGAAGAC (WWP1), mRNA /cds=(10,2778) AGGTGCTTGAACTTGTCAGTTTGT 1237 Table 3A Hs.273294 AL136797 12053106 mRNA
20% 3-17-23
Color:Dreamsicle Delight (Lam)
3) Worden's Flatfish Lure Looking for something that will drive rainbow trout crazy
and Fuji guides
Exchange/Return Notes
- We offer a 30-day return/exchange service after receiving.
- Final sale items are not eligible for returns or exchanges.
- To process your return/exchange, please contact us at [email protected]
- Please click here for more details>>> Return & Exchange Policy
You may also like
US$ 20.76
US$ 24.06
US$ 29.31
US$ 29.85
US$ 21.21
US$ 23.69
US$ 27.27
US$ 24.99
US$ 28.79